Gödel, Escher, Bach

Branislav Dudáš, 15. októbra 2012

Je možné spojiť pár jednoduchých častí a dostať niečo zložitejšie, ako je súčet týchto častí? Vedci vedia, ako funguje jeden neurón, tušia aj ako vám skupina neurónov umožní pohnúť prstom pri posúvaní tohto článku, ale sto miliárd mozgových buniek je šialene komplikovaný systém. Vznikajú skupiny skupín skupín, ktorých jednoduché fungovanie nakoniec vytvorí ľudské vedomie, myseľ a inteligenciu. Dokážeme vytvoriť niečo podobné?

V mozku každého člověka je zase zabudována určitá míra naivity. Nakolik naivní jste vy? Nachází se vaše naivita v jakémsi “centru naivity” ve vašem mozku? Mohl by zasáhnout neurochirurg a provést jemnou operaci, která by míru vaší naivity snížila a jinak by se vás nedotkla? Pokud tomu věříte, jste dost naivní a možná byste o takové operaci měli uvažovat.

Fungovanie mozgu prebieha na viacerých, jednoduchých a zložitých, úrovniach a vedomé ľudské myšlienky sú produktom interakcií medzi týmito úrovňami. Otázne je, či je všetky tieto úrovne možné znázorniť matematicky? To by nás priviedlo k možnosti vytvorenia skutočnej inteligencie, nie len stroja jednajúceho na základe pravidiel “ak X, tak urob Y”. Na to však potrebujeme program, ktorý by bol schopný prepisovať sám seba a pridávať ďalšie úrovne. Pozor, blížime sa k zložitým matematickým systémom a k nekonečnu.

Komutativita a asociativita v násobení jsou předpoklady, které říkají, že když budeme takovým tělesem různě otáčet, počet kostek v něm se nezmění. Tyto předpoklady se ale nedají ověřit pro všechny možné případy, protože počet takových případů je nekonečný. Bereme je jako dané; věříme v ně (pokud na ně vůbec myslíme) tak hluboce, jak jen něčemu věřit lze. Když půjdeme po ulici a kapse se nám budou přesypávat peníze, jejich celková částka se nezmění; nezmění se ani počet našich knih, když je sbalíme do krabice, naložíme do auta, popojedeme sto kilometrů, krabici vyložíme, rozbalíme a knihy dáme do nové police. To vše je součástí fenoménu, jemuž říkáme číslo.

Názov článku (a knihy, ku ktorej sa dostanem za chvíľu) nie je zvolený náhodne. Základom nášho mentálneho experimentu sú traja velikáni: Kurt Gödel a jeho teória neúplnosti (Gödelova veta), ktorá hovorí, že nech vytvoríte akúkoľvek zložitý číselnú teóriu, tak bude obsahovať tvrdenia, ktoré s jej pomocou nebudete vedieť dokázať. Druhý bude M.C. Escher a jeho skvelé obrazy zobrazujúce paradoxy perspektívneho kreslenia a tretí Johann Sebastian Bach s jeho mnohoúrovňovými fugami. Ich diela nám poslúžia ako skvelé príklady, od ktorých sa budeme môcť odraziť pri hľadaní odpovedí.

Každý ví, že blázni interpretují svět svou vlastní logikou, podivnou, ale konzistentní. Jak můžete vědět, jestli je vaše logika “podivná” nebo ne, když k posouzení všeho máte jen svou vlastní logiku? Odpověď na tuto otázku neznám, jen si v této souvislosti vybavuji druhou Gödelovu větu, podle níž jsou sporné jen ty verze formální teorie čísel, které o sobě tvrdí, že jsou bezesporné…

Takto začína Douglas R. Hofstadter, autor knihy Gödel, Escher, Bach – Existencionální gordická balada / Metaforická fuga o mysli a strojích v duchu Lewise Carrolla, svoje monumentálne pátranie po možnostiach vytvorenia umelej inteligencie. Dostal za ňu dokonca Pulitzerovu cenu. Autor sa ohromne snaží podať svoje myšlienky čo najjednoduchšie, vysvetľuje aj základy elementárnej matematiky, len aby sa čitateľ v jeho diele nestratil. Mnoho ľudí sa nakoniec aj tak stratí. Táto kniha nie je vhodná na plážové čítanie. Kniha sa nedá čítať ako detektívka od rána do večera. Práve naopak, treba si nechávať čas vstrebať myšlienky, skúšať experimenty a hádanky, ktoré autor navrhuje.

Důkladný výzkum druhu Felis silvestris f. catus (kočka domácí) odhalil, že někdy skutečně lze přímo z genotypu vyčíst fenotyp. Čtenář snad tuto pozoruhodnou skutečnost lépe ocení, když si prohlédne nasledujíci úsek DNA Felis catus:

…CATCATCATCATCATCATCATCATCATCAT…

V knihe sa striedajú dva formáty – klasický náučný a druhý divadelný, v ktorom vystupujú najmä postavy Zenónových apórií Achilles a Korytnačka. Ich úlohou je ukázať paradoxy, o ktorých sa hovorí v nasledujúcej kapitole a navnadiť čitateľa formou detských bábok. Oba formáty obsahujú inteligentné (niekedy až intelektuálske) myšlienky, ktoré sa určite oplatí čítať.

Uvažme jak přirozené je sklouznout od bezhodnotového deklarativu “neumím rusky” přes hodnotově nabitější kondicionál “rád bych uměl rusky” až k hlubokému kontrafaktuálnímu hypotetikálu “kdybych tak uměl rusky, četl bych Čechova a Lermontova v originále”. Jak pustá a mrtvá je mysl, která v negaci nevidí nic než temnou bariéru! Otevřená mysl ji nahlíží jako okno do světa možností.

Otázne je, či sa knihu Gödel, Escher, Bach oplatí čítať každému. Ak vás však zaujíma inteligencia, najmä tá umelá, pamätáte si ešte niečo z matematiky zo strednej školy a chcete vystúpiť zo svojej zóny komfortu, tak Douglas R. Hofstadter napísal (a tiež pomáhal preložiť!) knihu pre vás! Kúpiť si ju môžete v tomto kníhkupectve.

Takmer dôležitá informácia:

Nemoderovaná diskusia má zásadný vplyv na to, aký pocit majú čitatelia z článku, ktorý čítali. Preto, ak chcete, môžete mi poslať ľubovoľný komentár cez tento odkaz. Ak mi ku komentáru napíšete aj mail, možno sa Vám ozvem späť. Ak Váš komentár bude zaujímavý, alebo si zaslúži odpoveď, zverejním ho.